UQCRC2 cDNA ORF Clone, Rhesus, C-HA tag

Price:
Size:
Number:

UQCRC2 cDNA ORF Clone, Rhesus, C-HA tag: General Information

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1362 bp
Description
Full length Clone DNA of Rhesus ubiquinol-cytochrome c reductase core protein II with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

UQCRC2 Background Information

Ubiquinol-cytochrome-c reductase core protein 2 (UQCRC2) is a component of ubiquinol-cytochrome c reductase complex that is known to correlate with male fertility via spermatogenesis. Simultaneously, nutlin-3a is a small molecule antagonist of mouse double minute 2 repressor (MDM2), activate p53 and induce apoptosis responsible for spermatogenesis. UQCRC2 can also interactive with NLRX1, the only member of the Nod-like receptor (NLR) family, providing a molecular basis for the role of NLRX1 in ROS generation.
Full Name
ubiquinol-cytochrome c reductase core protein II
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait