After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Яванский макак UCHL1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus UCHL1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_005554754.1
Размер кДНК:672bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase).
Синоним гена:UCH-L1
Виды:Cynomolgus
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Яванский макак UCHL1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Яванский макак UCHL1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90725-ACGRBS15396
Яванский макак UCHL1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90725-ACRRBS15396
Яванский макак UCHL1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90725-ANGRBS15396
Яванский макак UCHL1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90725-ANRRBS15396
Яванский макак UCHL1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90725-CFRBS13343
Яванский макак UCHL1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90725-CHRBS13343
Яванский макак UCHL1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90725-CMRBS13343
Яванский макак UCHL1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90725-CYRBS13343
Яванский макак UCHL1 Джин клон кДНК в вектор клонированияCG90725-GRBS5132
Яванский макак UCHL1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90725-NFRBS13343
Яванский макак UCHL1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90725-NHRBS13343
Яванский макак UCHL1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90725-NMRBS13343
Яванский макак UCHL1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90725-NYRBS13343
Яванский макак UCHL1 Джин ORF экспрессии кДНК клона плазмидыCG90725-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Ubiquitin carboxyl-terminal hydrolase isozyme L1, also known as UCH-L1, Ubiquitin thioesterase L1, PGP9.5 and UCHL1, is a deubiqutinating enzyme with important functions in recycling of ubiquitin. Regulated proteolysis by the ubiquitin pathway has been implicated in control of the cell cycle, transcriptional activation, cell fate and growth, and synaptogenesis. The ubiquitin-proteasome system is involved in synaptic plasticity and is proposed to be part of a molecular switch that converts short-term synaptic potentiation to long-term changes in synaptic strength. UCHL1 is found in neuronal cell bodies and processes throughout the neocortex (at protein level). It is expressed in neurons and cells of the diffuse neuroendocrine system and their tumors. UCHL1 is weakly expressed in ovary. UCHL1 is a ubiquitin-protein hydrolase. It is involved both in the processing of ubiquitin precursors and of ubiquitinated proteins. This enzyme is a thiol protease that recognizes and hydrolyzes a peptide bond at the C-terminal glycine of ubiquitin. UCHL1 also binds to free monoubiquitin and may prevent its degradation in lysosomes. The homodimer of UCHL1 may have ATP-independent ubiquitin ligase activity. UCHL1 dysfunction has been associated with neurodegeneration in Parkinson's, Alzheimer's, and Huntington's disease patients. Reduced UCHL1 function may jeopardize the survival of CNS neurons.

Ссылки
  • Wada H., et al., 1998, Biochem. Biophys. Res. Commun. 251:688-92.
  • Choi J., et al., 2004, J. Biol. Chem. 279:13256-64.
  • Lombardino,A.2005, et al., J.Proc Natl Acad Sci.USA102 (22):8036-41
  • Okochi-Takada,E. et al., 2006, Int J Cancer. 119 (6):1338-44.
  • Zetterberg, M. et al., 2010, Mol Neurodegener  5 :11.
  • Size / Price
    Каталог: CG90725-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».