Быстрый заказ

Яванский макак UBE1 / UBA1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus UBA1 Информация о продукте «Клон cDNA»
Размер кДНК:3177bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) ubiquitin-like modifier activating enzyme 1 with N terminal Myc tag.
Синоним гена:UBA1
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Яванский макак UBE1 / UBA1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Яванский макак UBE1 / UBA1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90821-ACGRBS22240
Яванский макак UBE1 / UBA1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90821-ACRRBS22240
Яванский макак UBE1 / UBA1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90821-ANGRBS22240
Яванский макак UBE1 / UBA1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90821-ANRRBS22240
Яванский макак UBE1 / UBA1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90821-CFRBS20190
Яванский макак UBE1 / UBA1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90821-CHRBS20190
Яванский макак UBE1 / UBA1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90821-CMRBS20190
Яванский макак UBE1 / UBA1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90821-CYRBS20190
Яванский макак UBE1 / UBA1 Джин клон кДНК в вектор клонированияCG90821-GRBS5130
Яванский макак UBE1 / UBA1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90821-NFRBS20190
Яванский макак UBE1 / UBA1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90821-NHRBS20190
Яванский макак UBE1 / UBA1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90821-NMRBS20190
Яванский макак UBE1 / UBA1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90821-NYRBS20190
Яванский макак UBE1 / UBA1 Джин ORF экспрессии кДНК клона плазмидыCG90821-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name

UBE1, also known as UBA1, belongs to the ubiquitin-activating E1 family. UBE1 gene complements an X-linked mouse temperature-sensitive defect in DNA synthesis, and thus may function in DNA repair. It is part of a gene cluster on chromosome Xp11.23. UBE1 catalyzes the first step in ubiquitin conjugation to mark cellular proteins for degradation. It also catalyzes the first step in ubiquitin conjugation to mark cellular proteins for degradation by first adenylating its C-terminal glycine residue with ATP, and thereafter linking this residue to the side chain of a cysteine residue in E1, yielding an ubiquitin-E1 thioester and free AMP. Defects in UBA1 can cause spinal muscular atrophy X-linked type 2 (SMAX2), also known as X-linked lethal infantile spinal muscular atrophy, distal X-linked arthrogryposis multiplex congenita or X-linked arthrogryposis type 1 (AMCX1). Spinal muscular atrophy refers to a group of neuromuscular disorders characterized by degeneration of the anterior horn cells of the spinal cord, leading to symmetrical muscle weakness and atrophy. SMAX2 is a lethal infantile form presenting with hypotonia, areflexia, and multiple congenital contractures.

  • Jin J, et al. (2007) Dual E1 activation systems for ubiquitin differentially regulate E2 enzyme charging. Nature. 447(7148):1135-8.
  • Xia T, et al. (2007) Chaperone-dependent E3 ligase CHIP ubiquitinates and mediates proteasomal degradation of soluble guanylyl cyclase. Am J Physiol Heart Circ Physiol. 293(5):H3080-7.
  • Pridgeon JW, et al. (2009) Proteomic analysis reveals Hrs UIM-mediated ubiquitin signaling in multiple cellular processes. FEBS J. 276(1):118-31.
  • Size / Price
    Каталог: CG90821-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.