Быстрый заказ

Яванский макак Thrombopoietin/THPO Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus THPO Информация о продукте «Клон cDNA»
Размер кДНК:1062bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) thrombopoietin with N terminal Myc tag.
Синоним гена:THO, THPO
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Яванский макак Thrombopoietin/THPO Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Яванский макак Thrombopoietin/THPO Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90004-ACGRBS15400
Яванский макак Thrombopoietin/THPO Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90004-ACRRBS15400
Яванский макак Thrombopoietin/THPO Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90004-CFRBS13340
Яванский макак Thrombopoietin/THPO Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90004-CHRBS13340
Яванский макак Thrombopoietin/THPO Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90004-CMRBS13340
Яванский макак Thrombopoietin/THPO Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90004-CYRBS13340
Яванский макак Thrombopoietin/THPO Джин клон кДНК в вектор клонированияCG90004-GRBS5130
Яванский макак Thrombopoietin/THPO Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90004-NFRBS13340
Яванский макак Thrombopoietin/THPO Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90004-NHRBS13340
Яванский макак Thrombopoietin/THPO Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90004-NMRBS13340
Яванский макак Thrombopoietin/THPO Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90004-NYRBS13340
Яванский макак Thrombopoietin/THPO Джин ORF экспрессии кДНК клона плазмидыCG90004-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Thrombopoietin (TPO or THPO), also known as myeloproliferative leukemia virus ligand (c-Mpl), is a hematopoietic growth factor belonging to the EPO/TPO family. The thrombopoietin protein is produced mainly by the liver and the kidney that regulates the production of platelets by the bone marrow. Thrombopoietin protein stimulates both proliferation of progenitor megakaryocytes and their maturation to platelet-producing megakaryocytes, and also accelerates the recovery of platelets. Thrombopoietin protein is involved in cardiovascular disease as it regulates megakaryocyte development and enhances platelet adhesion/aggregation. It has been identified that surface c-MPL, the receptor for thrombopoietin protein, binds to the ligand and mediates the action.

  • Ryu T,et al.(2003) Thrombopoietin-producing hepatocellular carcinoma. Intern Med. 42(8): 730-4.
  • Higashihara M,et al. (2003) Thrombopoietin-producing tumor. Intern Med. 42(8): 632-3?
  • Size / Price
    Каталог: CG90004-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.