Быстрый заказ

Яванский макак Thioredoxin-2/TXN2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus TXN2 Информация о продукте «Клон cDNA»
Размер кДНК:501bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) thioredoxin 2 with N terminal HA tag.
Синоним гена:TXN2
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Яванский макак Thioredoxin-2/TXN2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Яванский макак Thioredoxin-2/TXN2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90415-ACGRBS15400
Яванский макак Thioredoxin-2/TXN2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90415-ACRRBS15400
Яванский макак Thioredoxin-2/TXN2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90415-CFRBS13340
Яванский макак Thioredoxin-2/TXN2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90415-CHRBS13340
Яванский макак Thioredoxin-2/TXN2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90415-CMRBS13340
Яванский макак Thioredoxin-2/TXN2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90415-CYRBS13340
Яванский макак Thioredoxin-2/TXN2 Джин клон кДНК в вектор клонированияCG90415-GRBS5130
Яванский макак Thioredoxin-2/TXN2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90415-NFRBS13340
Яванский макак Thioredoxin-2/TXN2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90415-NHRBS13340
Яванский макак Thioredoxin-2/TXN2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90415-NMRBS13340
Яванский макак Thioredoxin-2/TXN2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90415-NYRBS13340
Яванский макак Thioredoxin-2/TXN2 Джин ORF экспрессии кДНК клона плазмидыCG90415-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Thioredoxin-2, also known as TXN2, MTRX and TRX2, is a member of the thioredoxin family. Tryparedoxins (TXN) are thioredoxin-related proteins which, as trypanothione:peroxiredoxin oxidoreductases, constitute the trypanothione-dependent antioxidant defense and may also serve as substrates for ribonucleotide reductase in trypanosomatids. Thioredoxin-2 / TXN2 contains one thioredoxin domain. It is widely expressed in adult (at protein level) and fetal tissues. Human Thioredoxin-2 / TXN2 is a small redox protein important in cellular antioxidant defenses, as well as in the regulation of apoptosis. Thioredoxin-2 / TXN2 has an anti-apoptotic function and plays an important role in the regulation of mitochondrial membrane potential. Thioredoxin-2 / TXN2 could be involved in the resistance to anti-tumor agents. It possesses a dithiol-reducing activity. Thioredoxin-2 / TXN2 plays an important role in protecting the mitochondria against oxidative stress and in sensitizing the cells to ROS-induced apoptosis. Mammalian Thioredoxin-2 / TXN2 is a mitochondrial isoform of highly evolutionary conserved thioredoxins. Thioredoxins are small ubiquitous protein-disulfide oxidoreductases implicated in a large variety of biological functions.

  • Chen Y., et al., 2002, J. Biol. Chem. 277: 33242-8.
  • Smeets A., et al., 2005, Protein Sci. 14: 2610-21.
  • Wen,S. et al., 2009, Am J Med Genet A  149A (2): 155-60.
  • Choudhary C., et al., 2009, Science 325: 834-40.
  • Size / Price
    Каталог: CG90415-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.