After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Яванский макак p53 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus TP53 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:AF456343.1
Размер кДНК:1182bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) tumor protein p53 with N terminal Myc tag.
Синоним гена:TP53
Виды:Cynomolgus
переносчик:pCMV3-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Яванский макак p53 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Яванский макак p53 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90001-ACGRBS15400
Яванский макак p53 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90001-ACRRBS15400
Яванский макак p53 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90001-ANGRBS15400
Яванский макак p53 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90001-ANRRBS15400
Яванский макак p53 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90001-CFRBS13340
Яванский макак p53 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90001-CHRBS13340
Яванский макак p53 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90001-CMRBS13340
Яванский макак p53 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90001-CYRBS13340
Яванский макак p53 Джин клон кДНК в вектор клонированияCG90001-GRBS5130
Яванский макак p53 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90001-NFRBS13340
Яванский макак p53 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90001-NHRBS13340
Яванский макак p53 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90001-NMRBS13340
Яванский макак p53 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90001-NYRBS13340
Яванский макак p53 Джин ORF экспрессии кДНК клона плазмидыCG90001-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

p53, also known as Tp53, is a DNA-binding protein which belongs to the p53 family. It contains transcription activation, DNA-binding, and oligomerization domains. p53 protein is expressed at low level in normal cells and at a high level in a variety of transformed cell lines, where it's believed to contribute to transformation and malignancy. p53 (TP53) is a transcription factor whose protein levels and post-translational modification state alter in response to cellular stress (such as DNA damage, hypoxia, spindle damage). Activation of p53 begins through a number of mechanisms including phosphorylation by ATM, ATR, Chk1 and MAPKs. MDM2 is a ubiquitn ligase that binds p53 and targets p53 for proteasomal degradation. Phosphorylation, p14ARF and USP7 prevent MDM2-p53 interactions, leading to an increase in stable p53 tetramers in the cytoplasm. Further modifications such as methylation and acetylation lead to an increase in Tp53 binding to gene specific response elements. Tp53 regulates a large number of genes (>100 genes) that control a number of key tumor suppressing functions such as cell cycle arrest, DNA repair, senescence and apoptosis. Whilst the activation of p53 often leads to apoptosis, p53 inactivation facilitates tumor progression. It is postulated to bind to a p53-binding site and activate expression of downstream genes that inhibit growth and/or invasion, and thus function as a tumor suppressor. Mutants of p53 that frequently occur in a number of different human cancers fail to bind the consensus DNA binding site, and hence cause the loss of tumor suppressor activity. Defects in TP53 are a cause of esophageal cancer, Li-Fraumeni syndrome, lung cancer and adrenocortical carcinoma.

Ссылки
  • Bakhrat A, et al. (2010) Drosophila Chk2 and p53 proteins induce stage-specific cell death independently during oogenesis. Apoptosis. 15(12):1425-34.
  • Kurzhals RL, et al. (2011) Chk2 and p53 are haploinsufficient with dependent and independent functions to eliminate cells after telomere loss. PLoS Genet. 7(6):e1002103.
  • Pardi N, et al. (2011) In vivo effects of abolishing the single canonical sumoylation site in the C-terminal region of Drosophila p53. Acta Biol Hung. 62(4):397-412.
  • Wells BS, et al. (2012) Maintenance of imaginal disc plasticity and regenerative potential in Drosophila by p53. Dev Biol. 361(2):263-76.
  • Size / Price
    Каталог: CG90001-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».