After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Яванский макак TOP3A Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus TOP3A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_005583073.1
Размер кДНК:3006bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) topoisomerase (DNA) III alpha with N terminal Flag tag.
Синоним гена:TOP3A
Виды:Cynomolgus
переносчик:pCMV3-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Яванский макак TOP3A Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Яванский макак TOP3A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90454-ACGRBS22240
Яванский макак TOP3A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90454-ACRRBS22240
Яванский макак TOP3A Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90454-ANGRBS22240
Яванский макак TOP3A Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90454-ANRRBS22240
Яванский макак TOP3A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90454-CFRBS20190
Яванский макак TOP3A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90454-CHRBS20190
Яванский макак TOP3A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90454-CMRBS20190
Яванский макак TOP3A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90454-CYRBS20190
Яванский макак TOP3A Джин клон кДНК в вектор клонированияCG90454-GRBS5130
Яванский макак TOP3A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90454-NFRBS20190
Яванский макак TOP3A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90454-NHRBS20190
Яванский макак TOP3A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90454-NMRBS20190
Яванский макак TOP3A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90454-NYRBS20190
Яванский макак TOP3A Джин ORF экспрессии кДНК клона плазмидыCG90454-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90454-NF
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».