After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Резус-фактор TNF-alpha/TNFA/TNFSF2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus TNF Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001047149.1
Размер кДНК:702bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) tumor necrosis factor with N terminal Myc tag.
Синоним гена:TNF-ALPHA, TNF
Виды:Rhesus
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Резус-фактор TNF-alpha/TNFA/TNFSF2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Резус-фактор TNF-alpha/TNFA/TNFSF2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90018-ACGRBS15400
Резус-фактор TNF-alpha/TNFA/TNFSF2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90018-ACRRBS15400
Резус-фактор TNF-alpha/TNFA/TNFSF2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90018-CFRBS13340
Резус-фактор TNF-alpha/TNFA/TNFSF2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90018-CHRBS13340
Резус-фактор TNF-alpha/TNFA/TNFSF2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90018-CMRBS13340
Резус-фактор TNF-alpha/TNFA/TNFSF2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90018-CYRBS13340
Резус-фактор TNF-alpha/TNFA/TNFSF2 Джин клон кДНК в вектор клонированияCG90018-GRBS5130
Резус-фактор TNF-alpha/TNFA/TNFSF2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90018-NFRBS13340
Резус-фактор TNF-alpha/TNFA/TNFSF2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90018-NHRBS13340
Резус-фактор TNF-alpha/TNFA/TNFSF2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90018-NMRBS13340
Резус-фактор TNF-alpha/TNFA/TNFSF2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90018-NYRBS13340
Резус-фактор TNF-alpha/TNFA/TNFSF2 Джин ORF экспрессии кДНК клона плазмидыCG90018-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Tumor necrosis factor alpha (TNF-alpha), also known as TNF, TNFA or TNFSF2, is the prototypic cytokine of the TNF superfamily, and is a multifunctional molecule involved in the regulation of a wide spectrum of biological processes including cell proliferation, differentiation, apoptosis, lipid metabolism, and coagulation. Two receptors, TNF-R1 (TNF receptor type 1; CD120a; p55/60) and TNF-R2 (TNF receptor type 2; CD120b; p75/80), bind to TNF-alpha. TNF-alpha protein is produced mainly by macrophages, and large amounts of this cytokine are released in response to lipopolysaccharide, other bacterial products, and Interleukin-1 (IL-1). TNF-alpha is involved in fighting against the tumorigenesis, thus, is regarded as a molecular insight in cancer treatment.

TNF-alpha Protein & Antibody

Ссылки
  • Hector J, et al. (2007) TNF-alpha alters visfatin and adiponectin levels in human fat. Horm Metab Res. 39(4): 250-5.
  • Berthold-Losleben M, et al. (2008) The TNF-alpha System: Functional Aspects in Depression, Narcolepsy and Psychopharmacology. Curr Neuropharmacol. 6(3): 193-202.
  • Size / Price
    Каталог: CG90018-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».