After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Резус-фактор TMUB2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus TMUB2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001194640.1
Размер кДНК:966bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) transmembrane and ubiquitin-like domain containing 2 with N terminal His tag.
Синоним гена:TMUB2
Виды:Rhesus
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Резус-фактор TMUB2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Резус-фактор TMUB2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90614-ACGRBS15400
Резус-фактор TMUB2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90614-ACRRBS15400
Резус-фактор TMUB2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90614-CFRBS13340
Резус-фактор TMUB2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90614-CHRBS13340
Резус-фактор TMUB2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90614-CMRBS13340
Резус-фактор TMUB2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90614-CYRBS13340
Резус-фактор TMUB2 Джин клон кДНК в вектор клонированияCG90614-GRBS5130
Резус-фактор TMUB2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90614-NFRBS13340
Резус-фактор TMUB2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90614-NHRBS13340
Резус-фактор TMUB2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90614-NMRBS13340
Резус-фактор TMUB2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90614-NYRBS13340
Резус-фактор TMUB2 Джин ORF экспрессии кДНК клона плазмидыCG90614-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90614-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».