Быстрый заказ

Резус-фактор TMEM59 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Резус-фактор TMEM59 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001266204.1
    Размер кДНК:975bp
    Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) transmembrane protein 59 with N terminal His tag.
    Синоним гена:TMEM59
    Виды:Rhesus
    переносчик:pCMV3-SP-N-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Резус-фактор TMEM59 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Резус-фактор TMEM59 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90620-ACGRBS15400
    Резус-фактор TMEM59 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90620-ACRRBS15400
    Резус-фактор TMEM59 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90620-CFRBS13340
    Резус-фактор TMEM59 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90620-CHRBS13340
    Резус-фактор TMEM59 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90620-CMRBS13340
    Резус-фактор TMEM59 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90620-CYRBS13340
    Резус-фактор TMEM59 Джин клон кДНК в вектор клонированияCG90620-GRBS5130
    Резус-фактор TMEM59 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90620-NFRBS13340
    Резус-фактор TMEM59 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90620-NHRBS13340
    Резус-фактор TMEM59 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90620-NMRBS13340
    Резус-фактор TMEM59 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90620-NYRBS13340
    Резус-фактор TMEM59 Джин ORF экспрессии кДНК клона плазмидыCG90620-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: CG90620-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».