Быстрый заказ

Резус-фактор TMEM101 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Яванский макак TMEM101 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001194622.1
    Размер кДНК:774bp
    Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) transmembrane protein 101.
    Синоним гена:TMEM101
    Виды:Rhesus
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Резус-фактор TMEM101 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Резус-фактор TMEM101 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90735-ACGRBS15400
    Резус-фактор TMEM101 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90735-ACRRBS15400
    Резус-фактор TMEM101 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90735-CFRBS13340
    Резус-фактор TMEM101 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90735-CHRBS13340
    Резус-фактор TMEM101 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90735-CMRBS13340
    Резус-фактор TMEM101 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90735-CYRBS13340
    Резус-фактор TMEM101 Джин клон кДНК в вектор клонированияCG90735-GRBS5130
    Резус-фактор TMEM101 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90735-NFRBS13340
    Резус-фактор TMEM101 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90735-NHRBS13340
    Резус-фактор TMEM101 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90735-NMRBS13340
    Резус-фактор TMEM101 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90735-NYRBS13340
    Резус-фактор TMEM101 Джин ORF экспрессии кДНК клона плазмидыCG90735-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: CG90735-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».