After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Резус-фактор TMEM101 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus TMEM101 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001194622.1
Размер кДНК:774bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) transmembrane protein 101.
Синоним гена:TMEM101
Виды:Rhesus
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Резус-фактор TMEM101 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Резус-фактор TMEM101 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90735-ACGRBS15396
Резус-фактор TMEM101 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90735-ACRRBS15396
Резус-фактор TMEM101 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90735-CFRBS13343
Резус-фактор TMEM101 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90735-CHRBS13343
Резус-фактор TMEM101 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90735-CMRBS13343
Резус-фактор TMEM101 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90735-CYRBS13343
Резус-фактор TMEM101 Джин клон кДНК в вектор клонированияCG90735-GRBS5132
Резус-фактор TMEM101 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90735-NFRBS13343
Резус-фактор TMEM101 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90735-NHRBS13343
Резус-фактор TMEM101 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90735-NMRBS13343
Резус-фактор TMEM101 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90735-NYRBS13343
Резус-фактор TMEM101 Джин ORF экспрессии кДНК клона плазмидыCG90735-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90735-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».