After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Резус-фактор TGFBR2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus TGFBR2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_001095987.2
Размер кДНК:1704bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) transforming growth factor, beta receptor II (70/80kDa) with C terminal Myc tag.
Синоним гена:TGFBR2
Виды:Rhesus
переносчик:pCMV3-C-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Резус-фактор TGFBR2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Резус-фактор TGFBR2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90063-ACGRBS16760
Резус-фактор TGFBR2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90063-ACRRBS16760
Резус-фактор TGFBR2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90063-CFRBS14710
Резус-фактор TGFBR2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90063-CHRBS14710
Резус-фактор TGFBR2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90063-CMRBS14710
Резус-фактор TGFBR2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90063-CYRBS14710
Резус-фактор TGFBR2 Джин клон кДНК в вектор клонированияCG90063-GRBS5130
Резус-фактор TGFBR2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90063-NFRBS14710
Резус-фактор TGFBR2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90063-NHRBS14710
Резус-фактор TGFBR2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90063-NMRBS14710
Резус-фактор TGFBR2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90063-NYRBS14710
Резус-фактор TGFBR2 Джин ORF экспрессии кДНК клона плазмидыCG90063-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

TGFBR2 is member of the Ser/Thr protein kinase family and the TGFB receptor subfamily. It is a transmembrane protein. TGFBR2 is comprised by a C-terminal protein kinase domain and an N-terminal ectodomain. The ectodomain consists of a compact fold containing nine beta-strands and a single helix stabilised by a network of six intra strand disulphide bonds. The folding topology includes a central five-stranded antiparallel beta-sheet, eight-residues long at its centre, covered by a second layer consisting of two segments of two-stranded antiparallel beta-sheets. TGFBR2 has a protein kinase domain, forms a heterodimeric complex with another receptor protein, and binds TGF-beta. This receptor/ligand complex phosphorylates proteins, which then enter the nucleus and regulate the transcription of a subset of genes related to cell proliferation. Mutations in TGFBR2 gene have been associated with Marfan syndrome, Loeys-Deitz Aortic Aneurysm Syndrome, and the development of various types of tumors. TGFBR2 attenuates the biological activities of TGF-beta in colorectal cancer. TGFBR2 expression is increased in oral squamous cell carcinoma cells. Its expression is decreased by IL-1beta while inducing Sp3 via NFkappaB. TGFB2 and TGFBR2 are involved in the antiestrogenic activity.

Ссылки
  • Yu Y, et al. (2012) MicroRNA-21 induces stemness by downregulating transforming growth factor beta receptor 2 (TGFβR2) in colon cancer cells. Carcinogenesis. 33(1):68-76.
  • Shima K, et al. (2011) TGFBR2 and BAX mononucleotide tract mutations, microsatellite instability, and prognosis in 1072 colorectal cancers. PLoS One. 6(9):e25062.
  • Biros E, et al. (2011) Meta-analysis of the association between single nucleotide polymorphisms in TGF-β receptor genes and abdominal aortic aneurysm. Atherosclerosis. 219(1):218-23.
  • Size / Price
    Каталог: CG90063-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».