Быстрый заказ

Text Size:AAA

Яванский макак C1ORF144 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus SZRD1 Информация о продукте «Клон cDNA»
Размер кДНК:399bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) SUZ RNA binding domain containing 1 with C terminal His tag.
Синоним гена:SZRD1
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Яванский макак C1ORF144 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Яванский макак C1ORF144 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90370-ACGRBS15400
Яванский макак C1ORF144 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90370-ACRRBS15400
Яванский макак C1ORF144 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90370-ANGRBS15400
Яванский макак C1ORF144 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90370-ANRRBS15400
Яванский макак C1ORF144 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90370-CFRBS13340
Яванский макак C1ORF144 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90370-CHRBS13340
Яванский макак C1ORF144 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90370-CMRBS13340
Яванский макак C1ORF144 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90370-CYRBS13340
Яванский макак C1ORF144 Джин клон кДНК в вектор клонированияCG90370-GRBS5130
Яванский макак C1ORF144 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90370-NFRBS13340
Яванский макак C1ORF144 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90370-NHRBS13340
Яванский макак C1ORF144 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90370-NMRBS13340
Яванский макак C1ORF144 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90370-NYRBS13340
Яванский макак C1ORF144 Джин ORF экспрессии кДНК клона плазмидыCG90370-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90370-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.