Быстрый заказ

Text Size:AAA

Яванский макак SYNGR4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus SYNGR4 Информация о продукте «Клон cDNA»
Размер кДНК:690bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) synaptogyrin 4 with N terminal Flag tag.
Синоним гена:SYNGR4
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Яванский макак SYNGR4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Яванский макак SYNGR4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90442-ACGRBS15400
Яванский макак SYNGR4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90442-ACRRBS15400
Яванский макак SYNGR4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90442-ANGRBS15400
Яванский макак SYNGR4 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90442-ANRRBS15400
Яванский макак SYNGR4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90442-CFRBS13340
Яванский макак SYNGR4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90442-CHRBS13340
Яванский макак SYNGR4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90442-CMRBS13340
Яванский макак SYNGR4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90442-CYRBS13340
Яванский макак SYNGR4 Джин клон кДНК в вектор клонированияCG90442-GRBS5130
Яванский макак SYNGR4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90442-NFRBS13340
Яванский макак SYNGR4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90442-NHRBS13340
Яванский макак SYNGR4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90442-NMRBS13340
Яванский макак SYNGR4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90442-NYRBS13340
Яванский макак SYNGR4 Джин ORF экспрессии кДНК клона плазмидыCG90442-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90442-NF
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.