Быстрый заказ

Яванский макак STX1A Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Яванский макак STX1A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_005549374.1
Размер кДНК:867bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) syntaxin 1A (brain) with C terminal His tag.
Синоним гена:STX1A
Виды:Cynomolgus
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Яванский макак STX1A Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Яванский макак STX1A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90352-ACGRBS15400
Яванский макак STX1A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90352-ACRRBS15400
Яванский макак STX1A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90352-CFRBS13340
Яванский макак STX1A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90352-CHRBS13340
Яванский макак STX1A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90352-CMRBS13340
Яванский макак STX1A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90352-CYRBS13340
Яванский макак STX1A Джин клон кДНК в вектор клонированияCG90352-GRBS5130
Яванский макак STX1A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90352-NFRBS13340
Яванский макак STX1A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90352-NHRBS13340
Яванский макак STX1A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90352-NMRBS13340
Яванский макак STX1A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90352-NYRBS13340
Яванский макак STX1A Джин ORF экспрессии кДНК клона плазмидыCG90352-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90352-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».