Быстрый заказ

Яванский макак SNAP25 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus SNAP25 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_005568355.1
Размер кДНК:621bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) synaptosomal-associated protein, 25kDa with C terminal His tag.
Синоним гена:SNAP25
Виды:Cynomolgus
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Яванский макак SNAP25 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Яванский макак SNAP25 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90343-ACGRBS15400
Яванский макак SNAP25 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90343-ACRRBS15400
Яванский макак SNAP25 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90343-ANGRBS15400
Яванский макак SNAP25 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90343-ANRRBS15400
Яванский макак SNAP25 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90343-CFRBS13340
Яванский макак SNAP25 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90343-CHRBS13340
Яванский макак SNAP25 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90343-CMRBS13340
Яванский макак SNAP25 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90343-CYRBS13340
Яванский макак SNAP25 Джин клон кДНК в вектор клонированияCG90343-GRBS5130
Яванский макак SNAP25 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90343-NFRBS13340
Яванский макак SNAP25 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90343-NHRBS13340
Яванский макак SNAP25 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90343-NMRBS13340
Яванский макак SNAP25 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90343-NYRBS13340
Яванский макак SNAP25 Джин ORF экспрессии кДНК клона плазмидыCG90343-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Synaptosomal-associated protein 25, also known as Super protein, Synaptosomal-associated 25 kDa protein, SNAP25 and SNAP, is a cytoplasm and cell membrane protein which belongs to the SNAP-25 family. SNAP25 / SUP contains 2 t-SNARE coiled-coil homology domains. SNAP25 / SUP is a membrane bound protein anchored to the cytosolic face of membranes via palmitoyl side chains in the middle of the molecule. SNAP25 / SUP protein is a component of the SNARE complex, which is proposed to account for the specificity of membrane fusion and to directly execute fusion by forming a tight complex that brings the synaptic vesicle and plasma membranes together. SNAP25 / SUP is a Q-SNARE protein contributing two α-helices in the formation of the exocytotic fusion complex in neurons where it assembles with syntaxin-1 and synaptobrevin. SNAP25 / SUP is involved in the molecular regulation of neurotransmitter release. It may play an important role in the synaptic function of specific neuronal systems. SNAP25 / SUP associates with proteins involved in vesicle docking and membrane fusion. SNAP25 / SUP regulates plasma membrane recycling through its interaction with CENPF. SNAP25 / SUP inhibits P/Q- and L-type voltage-gated calcium channels located presynaptically and interacts with the synaptotagmin C2B domain in Ca2+-independent fashion. In glutamatergic synapses SNAP25 / SUP decreases the Ca2+ responsiveness, while it is naturally absent in GABAergic synapses.

Ссылки
  • Hodel A ,et al.,1998, Int. J. Biochem. Cell Biol. 30 (10): 1069-73.
  • Sudhof TC, et al.,2002, Nat Rev Neurosci 3 (8): 641-653.
  • Chapman ER et al.,2002, Nat. Rev. Mol. Cell Biol. 3(7): 498-508.
  • Chen X., et al., 2002, Neuron 33:397-409.
  • Huang Q., et al., 2008, FEBS Lett. 582:1431-1436.
  • Size / Price
    Каталог: CG90343-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».