Быстрый заказ

Яванский макак SLC31A2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus SLC31A2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_005581036.1
Размер кДНК:432bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) solute carrier family 31 (copper transporter), member 2 with N terminal Myc tag.
Синоним гена:SLC31A2
Виды:Cynomolgus
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Яванский макак SLC31A2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Яванский макак SLC31A2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90665-ACGRBS15396
Яванский макак SLC31A2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90665-ACRRBS15396
Яванский макак SLC31A2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90665-CFRBS13343
Яванский макак SLC31A2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90665-CHRBS13343
Яванский макак SLC31A2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90665-CMRBS13343
Яванский макак SLC31A2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90665-CYRBS13343
Яванский макак SLC31A2 Джин клон кДНК в вектор клонированияCG90665-GRBS5132
Яванский макак SLC31A2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90665-NFRBS13343
Яванский макак SLC31A2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90665-NHRBS13343
Яванский макак SLC31A2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90665-NMRBS13343
Яванский макак SLC31A2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90665-NYRBS13343
Яванский макак SLC31A2 Джин ORF экспрессии кДНК клона плазмидыCG90665-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90665-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».