After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Резус-фактор SLC25A3 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus SLC25A3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001257587.1
Размер кДНК:1086bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3.
Синоним гена:SLC25A3
Виды:Rhesus
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Резус-фактор SLC25A3 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Резус-фактор SLC25A3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90738-ACGRBS15400
Резус-фактор SLC25A3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90738-ACRRBS15400
Резус-фактор SLC25A3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90738-ANGRBS15400
Резус-фактор SLC25A3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90738-ANRRBS15400
Резус-фактор SLC25A3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90738-CFRBS13340
Резус-фактор SLC25A3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90738-CHRBS13340
Резус-фактор SLC25A3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90738-CMRBS13340
Резус-фактор SLC25A3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90738-CYRBS13340
Резус-фактор SLC25A3 Джин клон кДНК в вектор клонированияCG90738-GRBS5130
Резус-фактор SLC25A3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90738-NFRBS13340
Резус-фактор SLC25A3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90738-NHRBS13340
Резус-фактор SLC25A3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90738-NMRBS13340
Резус-фактор SLC25A3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90738-NYRBS13340
Резус-фактор SLC25A3 Джин ORF экспрессии кДНК клона плазмидыCG90738-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».