Быстрый заказ

Яванский макак SH3TC1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Яванский макак SH3TC1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:AB046629.2
    Размер кДНК:447bp
    Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) SH3 domain and tetratricopeptide repeats 1 with N terminal Myc tag.
    Синоним гена:SH3TC1
    Виды:Cynomolgus
    переносчик:pCMV3-N-Myc
    Plasmid:
    Участок рестрикции:
    Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Яванский макак SH3TC1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
    Яванский макак SH3TC1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90830-ACGRBS15400
    Яванский макак SH3TC1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90830-ACRRBS15400
    Яванский макак SH3TC1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90830-ANGRBS15400
    Яванский макак SH3TC1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90830-ANRRBS15400
    Яванский макак SH3TC1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90830-CFRBS13340
    Яванский макак SH3TC1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90830-CHRBS13340
    Яванский макак SH3TC1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90830-CMRBS13340
    Яванский макак SH3TC1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90830-CYRBS13340
    Яванский макак SH3TC1 Джин клон кДНК в вектор клонированияCG90830-GRBS5130
    Яванский макак SH3TC1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90830-NFRBS13340
    Яванский макак SH3TC1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90830-NHRBS13340
    Яванский макак SH3TC1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90830-NMRBS13340
    Яванский макак SH3TC1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90830-NYRBS13340
    Яванский макак SH3TC1 Джин ORF экспрессии кДНК клона плазмидыCG90830-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: CG90830-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».