Быстрый заказ

Яванский макак SH3TC1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus SH3TC1 Информация о продукте «Клон cDNA»
Размер кДНК:447bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) SH3 domain and tetratricopeptide repeats 1 with C terminal HA tag.
Синоним гена:SH3TC1
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Яванский макак SH3TC1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Яванский макак SH3TC1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90830-ACGRBS15396
Яванский макак SH3TC1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90830-ACRRBS15400
Яванский макак SH3TC1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90830-ANGRBS15396
Яванский макак SH3TC1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90830-ANRRBS15400
Яванский макак SH3TC1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90830-CFRBS13340
Яванский макак SH3TC1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90830-CHRBS13343
Яванский макак SH3TC1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90830-CMRBS13340
Яванский макак SH3TC1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90830-CYRBS13343
Яванский макак SH3TC1 Джин клон кДНК в вектор клонированияCG90830-GRBS5130
Яванский макак SH3TC1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90830-NFRBS13340
Яванский макак SH3TC1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90830-NHRBS13343
Яванский макак SH3TC1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90830-NMRBS13343
Яванский макак SH3TC1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90830-NYRBS13340
Яванский макак SH3TC1 Джин ORF экспрессии кДНК клона плазмидыCG90830-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90830-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.