After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Яванский макак SerpinA3 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus SERPINA3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_005562128.1
Размер кДНК:1272bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3.
Синоним гена:SERPINA3
Виды:Cynomolgus
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Яванский макак SerpinA3 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Яванский макак SerpinA3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90719-ACGRBS15400
Яванский макак SerpinA3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90719-ACRRBS15400
Яванский макак SerpinA3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90719-CFRBS13340
Яванский макак SerpinA3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90719-CHRBS13340
Яванский макак SerpinA3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90719-CMRBS13340
Яванский макак SerpinA3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90719-CYRBS13340
Яванский макак SerpinA3 Джин клон кДНК в вектор клонированияCG90719-GRBS5130
Яванский макак SerpinA3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90719-NFRBS13340
Яванский макак SerpinA3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90719-NHRBS13340
Яванский макак SerpinA3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90719-NMRBS13340
Яванский макак SerpinA3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90719-NYRBS13340
Яванский макак SerpinA3 Джин ORF экспрессии кДНК клона плазмидыCG90719-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Human SerpinA3, also known as Alpha 1-antichymotrypsin (AACT), is a plasma alpha globulin glycoprotein, and is a member of serpin superfamily of the serine protease inhibitors consisting of at least 35 members. SerpinA3 has been demonstrated to inhibit the activity of certain serine proteases, such as cathepsin G found in neutrophils, and chymases present in mast cells, by inducing a major conformational rearrangement, and thus protects some tissues from damage caused by proteolytic enzymes. This enzyme is produced primarily in the liver, and is identified as an acute-phase inflammatory protein. SerpinA3 deficiency has been associated with liver disease, and mutations of this gene have been observed in patients with Parkinson disease and chronic obstructive pulmonary disease. In addition, ACT gene polymorphism has been implicated with Alzheimer’s disease (AD), cerebral amyloid angiopathy (CAA), as well as stroke, since SerpinA3 is a major constituent of the plaques in AD and an inhibitor of amyloid beta peptide degradation.

Ссылки
  • Nilsson, L.N. et al., 2001, J. Neurosci. 21: 1444-1451.
  • Ikari, Y. et al., 2001, J. Biol. Chem. 276: 11798-11803.
  • Vila, N. et al., 2000, Stroke. 31: 2103-2105
  • Eriksson, S. et al., 1995, Proc. Natl. Acad. Sci. USA. 92: 2313-2317.
  • Skeel, A. et al., 2001, J. Biol. Chem. 276: 21932-21937.
  • Size / Price
    Каталог: CG90719-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».