After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Резус-фактор CD62L/L-Selectin Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus SELL Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001042763.1
Размер кДНК:1119bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) selectin L with C terminal Flag tag.
Синоним гена:SELL
Виды:Rhesus
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Резус-фактор CD62L/L-Selectin Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Резус-фактор CD62L/L-Selectin Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90168-ACGRBS15400
Резус-фактор CD62L/L-Selectin Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90168-ACRRBS15400
Резус-фактор CD62L/L-Selectin Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90168-CFRBS13340
Резус-фактор CD62L/L-Selectin Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90168-CHRBS13340
Резус-фактор CD62L/L-Selectin Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90168-CMRBS13340
Резус-фактор CD62L/L-Selectin Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90168-CYRBS13340
Резус-фактор CD62L/L-Selectin Джин клон кДНК в вектор клонированияCG90168-GRBS5130
Резус-фактор CD62L/L-Selectin Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90168-NFRBS13340
Резус-фактор CD62L/L-Selectin Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90168-NHRBS13340
Резус-фактор CD62L/L-Selectin Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90168-NMRBS13340
Резус-фактор CD62L/L-Selectin Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90168-NYRBS13340
Резус-фактор CD62L/L-Selectin Джин ORF экспрессии кДНК клона плазмидыCG90168-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

L-selectin (SELL), also known as CD62L, is a key adhesion molecule that regulates both the migration of leukocytes at sites of inflammation and the recirculation of lymphocytes between blood and lymphoid tissues. It belongs to the selectin family of proteins, and consisting of a large, highly glycosylated, extracellular domain, a single spanning transmembrane domain and a small cytoplasmic tail. L-selectin is the only selectin expressed on leukocytes and mediates a number of leukocyte-endothelial interactions. L-selectin acts as a "homing receptor" for leukocytes to enter secondary lymphoid tissues via high endothelial venules. Ligands present on endothelial cells will bind to leukocyte expressing L-selectin, slowing leukocyte trafficking through the blood, and facilitating entry into a secondary lymphoid organ at that point. L-selectin-mediated lymphocyte recirculation is required for maintaining the appropriate tissue distribution of lymphocyte subpopulations including naïve and effector subsets such as regulatory T cells. In addition, L-selectin-mediated entry into peripheral lymph nodes is required for optimal induction of lymphocyte homeostatic proliferation during lymphopenia. Importantly, L-selectin has been shown to have both adhesive and signaling functions during leukocyte migration. L-selectin has also been shown to mediate leukocyte recruitment during chronic inflammatory and autoimmune diseases and thus is a potential therapeutic target for drug development.

Ссылки
  • Smalley DM, et al. (2005) L-selectin: mechanisms and physiological significance of ectodomain cleavage. J Cell Mol Med. 9(2): 255-66.
  • Grailer JJ, et al. (2009) L-selectin: role in regulating homeostasis and cutaneous inflammation. J Dermatol Sci. 56(3): 141-7.
  • Size / Price
    Каталог: CG90168-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».