After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Резус-фактор E-Selectin/CD62e/SELE Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus SELE Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_001094967.2
Размер кДНК:1833bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) selectin E with C terminal Flag tag.
Синоним гена:SELE
Виды:Rhesus
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Резус-фактор E-Selectin/CD62e/SELE Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Резус-фактор E-Selectin/CD62e/SELE Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90169-ACGRBS16760
Резус-фактор E-Selectin/CD62e/SELE Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90169-ACRRBS16760
Резус-фактор E-Selectin/CD62e/SELE Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90169-CFRBS14710
Резус-фактор E-Selectin/CD62e/SELE Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90169-CHRBS14710
Резус-фактор E-Selectin/CD62e/SELE Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90169-CMRBS14710
Резус-фактор E-Selectin/CD62e/SELE Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90169-CYRBS14710
Резус-фактор E-Selectin/CD62e/SELE Джин клон кДНК в вектор клонированияCG90169-GRBS5130
Резус-фактор E-Selectin/CD62e/SELE Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90169-NFRBS14710
Резус-фактор E-Selectin/CD62e/SELE Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90169-NHRBS14710
Резус-фактор E-Selectin/CD62e/SELE Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90169-NMRBS14710
Резус-фактор E-Selectin/CD62e/SELE Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90169-NYRBS14710
Резус-фактор E-Selectin/CD62e/SELE Джин ORF экспрессии кДНК клона плазмидыCG90169-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

E-selectin, also known as endothelial leukocyte adhesion molecule-1 (ELAM-1) and CD62E, is an inducible adhesion molecule that is expressed on the surfaces of stimulated vascular endothelial cells and is sometimes involved in cancer cell metastasis. E-selectin exhibits a complex mosaic structure consisting of a large extracellular region comprised of a lectin domain, an EGF-like domain, and a short consensus repeat (SCR) domain, followed by a transmembrane region and a relatively short (32 aa) cytoplasmic tail. As a member of the LEC-CAM or selectin family, E-selectin recognises and binds to sialylated carbohydrates including members of the Lewis X and Lewis A families found on monocytes, granulocytes, and T-lymphocytes. E-selectin supports rolling and stable arrest of leukocytes on activated vascular endothelium, and furthermore, it was indicated that it can also transduce an activating stimulus via the MAPK cascade into the endothelial cell during leukocyte adhesion. E-selectin regulates adhesive interactions between certain blood cells and endothelium. The soluble form of E selectin (sE-selectin) is a marker of endothelial activation, and has a potential role in the pathogenesis of cardiovascular disease as raised levels have been found in hypertension, diabetes and hyperlipidemia, although its association in established atherosclerosis disease and its value as a prognostic factor is more controversial. soluble E-selectin is inversely associated with the muscular component of the left ventricle, thereby suggesting that the lack of such a reparative factor may be associated with cardiac remodeling in end-stage renal disease (ESRD) patients. In addition, this adhesion molecule appears to be involved in the pathogenesis of atherosclerosis.

Ссылки
  • Roldn V, et al. (2003) Soluble E-selectin in cardiovascular disease and its risk factors. A review of the literature. Thromb Haemost. 90(6): 1007-20.
  • Kawase J, et al. (2009) Increase in E-selectin expression in umbilical vein endothelial cells by anticancer drugs and inhibition by cimetidine. Oncol Rep. 22(6): 1293-7.
  • Matsumoto K, et al. (2010) Soluble adhesion molecule E-selectin predicts cardiovascular events in Japanese patients with type 2 diabetes mellitus. Metabolism. 59(3): 320-4.
  • Stancanelli B, et al. (2010) Soluble e-selectin is an inverse and independent predictor of left ventricular wall thickness in end-stage renal disease patients. Nephron Clin Pract. 114(1): c74-80.
  • Size / Price
    Каталог: CG90169-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».