After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Яванский макак SCN2B Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus SCN2B Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_005579786.1
Размер кДНК:648bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) sodium channel, voltage-gated, type II, beta subunit with C terminal His tag.
Синоним гена:SCN2B
Виды:Cynomolgus
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Яванский макак SCN2B Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Яванский макак SCN2B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90365-ACGRBS15400
Яванский макак SCN2B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90365-ACRRBS15400
Яванский макак SCN2B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90365-CFRBS13340
Яванский макак SCN2B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90365-CHRBS13340
Яванский макак SCN2B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90365-CMRBS13340
Яванский макак SCN2B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90365-CYRBS13340
Яванский макак SCN2B Джин клон кДНК в вектор клонированияCG90365-GRBS5130
Яванский макак SCN2B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90365-NFRBS13340
Яванский макак SCN2B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90365-NHRBS13340
Яванский макак SCN2B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90365-NMRBS13340
Яванский макак SCN2B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90365-NYRBS13340
Яванский макак SCN2B Джин ORF экспрессии кДНК клона плазмидыCG90365-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

SCN2B plays a key role in the assembly, expression, and functional modulation of the heterotrimeric complex of the sodium channel. Voltage-gated sodium channels (NaV) are composed of one pore-forming alpha-subunit, which may be associated with either one or more beta-subunits. Alpha-subunits are composed for four homologous domains, each of which contains six transmembrane segments.They are responsible for action potential initiation and propagation in excitable cells, including nerve, muscle, and neuroendocrine cell types. SCN2B causes an increase in the plasma membrane surface area and in its folding into microvilli. SCN2B also interacts with TNR and may play a crucial role in clustering and regulation of activity of sodium channels at nodes of ranvier.

Ссылки
  • Kimura K, et al. (2006) Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes. Genome Res. 16(1):55-65.
  • Tan BH, et al. (2010) Sudden infant death syndrome-associated mutations in the sodium channel beta subunits. Heart Rhythm. 7(6):771-8.
  • Watanabe H, et al. (2009) Mutations in sodium channel beta1- and beta2-subunits associated with atrial fibrillation. Circ Arrhythm Electrophysiol. 2(3):268-75. Kimura K et al., 2006, Genome Res. 16(1):55-65.
  • Size / Price
    Каталог: CG90365-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».