Быстрый заказ

Text Size:AAA

Резус-фактор SCG5 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus SCG5 Информация о продукте «Клон cDNA»
Размер кДНК:639bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) secretogranin V (7B2 protein) with C terminal HA tag.
Синоним гена:SCG5
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Резус-фактор SCG5 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Резус-фактор SCG5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90389-ACGRBS15400
Резус-фактор SCG5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90389-ACRRBS15400
Резус-фактор SCG5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90389-CFRBS13340
Резус-фактор SCG5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90389-CHRBS13340
Резус-фактор SCG5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90389-CMRBS13340
Резус-фактор SCG5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90389-CYRBS13340
Резус-фактор SCG5 Джин клон кДНК в вектор клонированияCG90389-GRBS5130
Резус-фактор SCG5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90389-NFRBS13340
Резус-фактор SCG5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90389-NHRBS13340
Резус-фактор SCG5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90389-NMRBS13340
Резус-фактор SCG5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90389-NYRBS13340
Резус-фактор SCG5 Джин ORF экспрессии кДНК клона плазмидыCG90389-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90389-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.