After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Яванский макак RTN1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus RTN1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_005561390.1
Размер кДНК:582bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) reticulon 1 with C terminal His tag.
Синоним гена:RTN1
Виды:Cynomolgus
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Яванский макак RTN1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Яванский макак RTN1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90367-ACGRBS15400
Яванский макак RTN1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90367-ACRRBS15400
Яванский макак RTN1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90367-ANGRBS15400
Яванский макак RTN1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90367-ANRRBS15400
Яванский макак RTN1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90367-CFRBS13340
Яванский макак RTN1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90367-CHRBS13340
Яванский макак RTN1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90367-CMRBS13340
Яванский макак RTN1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90367-CYRBS13340
Яванский макак RTN1 Джин клон кДНК в вектор клонированияCG90367-GRBS5130
Яванский макак RTN1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90367-NFRBS13340
Яванский макак RTN1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90367-NHRBS13340
Яванский макак RTN1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90367-NMRBS13340
Яванский макак RTN1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90367-NYRBS13340
Яванский макак RTN1 Джин ORF экспрессии кДНК клона плазмидыCG90367-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90367-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».