Быстрый заказ

Text Size:AAA

Резус-фактор RTFDC1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus RTFDC1 Информация о продукте «Клон cDNA»
Размер кДНК:921bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) replication termination factor 2 domain containing 1 with C terminal Myc tag.
Синоним гена:C20orf43, C10H20orf43
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Резус-фактор RTFDC1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Резус-фактор RTFDC1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90428-ACGRBS15396
Резус-фактор RTFDC1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90428-ACRRBS15396
Резус-фактор RTFDC1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90428-ANGRBS15396
Резус-фактор RTFDC1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90428-ANRRBS15396
Резус-фактор RTFDC1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90428-CFRBS13343
Резус-фактор RTFDC1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90428-CHRBS13343
Резус-фактор RTFDC1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90428-CMRBS13343
Резус-фактор RTFDC1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90428-CYRBS13343
Резус-фактор RTFDC1 Джин клон кДНК в вектор клонированияCG90428-GRBS5132
Резус-фактор RTFDC1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90428-NFRBS13343
Резус-фактор RTFDC1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90428-NHRBS13343
Резус-фактор RTFDC1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90428-NMRBS13343
Резус-фактор RTFDC1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90428-NYRBS13343
Резус-фактор RTFDC1 Джин ORF экспрессии кДНК клона плазмидыCG90428-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90428-CM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.