After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Резус-фактор RPS4Y1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus RPS4Y1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001265622.1
Размер кДНК:792bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) ribosomal protein S4, X-linked.
Синоним гена:RPS4X
Виды:Rhesus
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Резус-фактор RPS4Y1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Резус-фактор RPS4Y1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90740-ACGRBS15396
Резус-фактор RPS4Y1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90740-ACRRBS15396
Резус-фактор RPS4Y1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90740-ANGRBS15396
Резус-фактор RPS4Y1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90740-ANRRBS15396
Резус-фактор RPS4Y1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90740-CFRBS13343
Резус-фактор RPS4Y1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90740-CHRBS13343
Резус-фактор RPS4Y1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90740-CMRBS13343
Резус-фактор RPS4Y1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90740-CYRBS13343
Резус-фактор RPS4Y1 Джин клон кДНК в вектор клонированияCG90740-GRBS5132
Резус-фактор RPS4Y1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90740-NFRBS13343
Резус-фактор RPS4Y1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90740-NHRBS13343
Резус-фактор RPS4Y1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90740-NMRBS13343
Резус-фактор RPS4Y1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90740-NYRBS13343
Резус-фактор RPS4Y1 Джин ORF экспрессии кДНК клона плазмидыCG90740-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90740-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».