Быстрый заказ

Яванский макак RNF167 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Яванский макак RNF167 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:XM_005582611.1
    Размер кДНК:1053bp
    Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) ring finger protein 167 with N terminal Myc tag.
    Синоним гена:RNF167
    Виды:Cynomolgus
    переносчик:pCMV3-SP-N-Myc
    Plasmid:
    Участок рестрикции:
    Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Яванский макак RNF167 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
    Яванский макак RNF167 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90666-ACGRBS15400
    Яванский макак RNF167 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90666-ACRRBS15400
    Яванский макак RNF167 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90666-CFRBS13340
    Яванский макак RNF167 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90666-CHRBS13340
    Яванский макак RNF167 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90666-CMRBS13340
    Яванский макак RNF167 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90666-CYRBS13340
    Яванский макак RNF167 Джин клон кДНК в вектор клонированияCG90666-GRBS5130
    Яванский макак RNF167 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90666-NFRBS13340
    Яванский макак RNF167 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90666-NHRBS13340
    Яванский макак RNF167 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90666-NMRBS13340
    Яванский макак RNF167 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90666-NYRBS13340
    Яванский макак RNF167 Джин ORF экспрессии кДНК клона плазмидыCG90666-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: CG90666-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».