Быстрый заказ

Резус-фактор RHEB/RHEB2 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Яванский макак RHEB Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001261182.1
    Размер кДНК:555bp
    Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) Ras homolog enriched in brain.
    Синоним гена:RHEB
    Виды:Rhesus
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Резус-фактор RHEB/RHEB2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Резус-фактор RHEB/RHEB2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90714-ACGRBS15400
    Резус-фактор RHEB/RHEB2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90714-ACRRBS15400
    Резус-фактор RHEB/RHEB2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90714-CFRBS13340
    Резус-фактор RHEB/RHEB2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90714-CHRBS13340
    Резус-фактор RHEB/RHEB2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90714-CMRBS13340
    Резус-фактор RHEB/RHEB2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90714-CYRBS13340
    Резус-фактор RHEB/RHEB2 Джин клон кДНК в вектор клонированияCG90714-GRBS5130
    Резус-фактор RHEB/RHEB2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90714-NFRBS13340
    Резус-фактор RHEB/RHEB2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90714-NHRBS13340
    Резус-фактор RHEB/RHEB2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90714-NMRBS13340
    Резус-фактор RHEB/RHEB2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90714-NYRBS13340
    Резус-фактор RHEB/RHEB2 Джин ORF экспрессии кДНК клона плазмидыCG90714-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    RHEB is a recently discovered member of the Ras superfamily that may be involved in neural plasticity. This function is novel and not typically associated with the Ras proteins. RHEB gene is a member of the small GTPase superfamily and encodes a lipid-anchored, cell membrane protein with five repeats of the RAS-related GTP-binding region. RHEB is vital in regulation of growth and cell cycle progression due to its role in the insulin / TOR / S6K signaling pathway. The protein has GTPase activity and shuttles between a GDP-bound form and a GTP-bound form, and farnesylation of RHEB is required for this activity. Three pseudogenes have been mapped, two on chromosome 10 and one on chromosome 22.

    Ссылки
  • Karbowniczek, et al. (2004) Regulation of B-Raf kinase activity by tuberin and Rheb is mammalian target of rapamycin (mTOR)-independent. J Biol Chem. 279(29):29930-7.
  • Long, et al. (2005) Rheb binds and regulates the mTOR kinase. Curr Biol. 15(8):702-13.
  • Mizuki N, et al. (1996) Isolation of cDNA and genomic clones of a human Ras-related GTP-binding protein gene and its chromosomal localization to the long arm of chromosome 7, 7q36. Genomics. 34(1):114-8.
  • Size / Price
    Каталог: CG90714-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».