After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Резус-фактор REG1B Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus REG1B Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001194568.1
Размер кДНК:501bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) regenerating islet-derived 1 beta with C terminal Flag tag.
Синоним гена:REG1B
Виды:Rhesus
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Резус-фактор REG1B Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Резус-фактор REG1B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90163-ACGRBS15400
Резус-фактор REG1B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90163-ACRRBS15400
Резус-фактор REG1B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90163-CFRBS13340
Резус-фактор REG1B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90163-CHRBS13340
Резус-фактор REG1B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90163-CMRBS13340
Резус-фактор REG1B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90163-CYRBS13340
Резус-фактор REG1B Джин клон кДНК в вектор клонированияCG90163-GRBS5130
Резус-фактор REG1B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90163-NFRBS13340
Резус-фактор REG1B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90163-NHRBS13340
Резус-фактор REG1B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90163-NMRBS13340
Резус-фактор REG1B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90163-NYRBS13340
Резус-фактор REG1B Джин ORF экспрессии кДНК клона плазмидыCG90163-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Regenerating gene (Reg), first isolated from a regenerating islet cDNA library, encodes a secretory protein with a growth stimulating effect on pancreatic beta cells, and could be associated with fibrocalculous pancreatopathy. Reg and Reg-related genes which were expressed in various organs have been revealed to constitute a multigene family, the Reg family consisting of four subtypes (types I, II, III, IV) and are involved in cancers and neurodegenerative diseases. Regenerating islet-derived 1 beta (REG1B), also known as Lithostathine-1-beta and Pancreatic stone protein 2 (PSPS2), is a types I Reg protein and contains one typical C-type lectin domain. REG1B is a 166-amino acid protein which has 22 amino acid substitutions in comparison with the previously isolated human REG1A, and it is was expressed only in pancreas. REG1B Is normally found in the exocrine pancreas, whereas in other tissues it appears either only under pathological conditions, such as Alzheimer's disease (brain), cancer (colon), or during regeneration such as neuronal sprouting in brain and pancreas regeneration. REG1B might act as an inhibitor of spontaneous calcium carbonate precipitation. The REG1A and REG1B gene and proteins could play different roles in the pancreas.

Ссылки
  • Moriizumi S, et al. (1994) Isolation, structural determination and expression of a novel reg gene, human regI beta. Biochim Biophys Acta. 1217(2): 199-202.
  • Sanchez D, et al. (2001) Preferential expression of reg I beta gene in human adult pancreas. Biochem Biophys Res Commun. 284(3): 729-37.
  • Boonyasrisawat W, et al. (2002) Analysis of the reg1alpha and reg1beta gene transcripts in patients with fibrocalculous pancreatopathy. Southeast Asian J Trop Med Public Health. 33(2): 365-72.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».