After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Резус-фактор RBBP4/RBAP48 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus RBBP4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001261038.1
Размер кДНК:1278bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) retinoblastoma binding protein 4.
Синоним гена:RBBP4
Виды:Rhesus
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Резус-фактор RBBP4/RBAP48 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Резус-фактор RBBP4/RBAP48 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90743-ACGRBS15400
Резус-фактор RBBP4/RBAP48 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90743-ACRRBS15400
Резус-фактор RBBP4/RBAP48 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90743-ANGRBS15400
Резус-фактор RBBP4/RBAP48 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90743-ANRRBS15400
Резус-фактор RBBP4/RBAP48 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90743-CFRBS13340
Резус-фактор RBBP4/RBAP48 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90743-CHRBS13340
Резус-фактор RBBP4/RBAP48 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90743-CMRBS13340
Резус-фактор RBBP4/RBAP48 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90743-CYRBS13340
Резус-фактор RBBP4/RBAP48 Джин клон кДНК в вектор клонированияCG90743-GRBS5130
Резус-фактор RBBP4/RBAP48 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90743-NFRBS13340
Резус-фактор RBBP4/RBAP48 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90743-NHRBS13340
Резус-фактор RBBP4/RBAP48 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90743-NMRBS13340
Резус-фактор RBBP4/RBAP48 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90743-NYRBS13340
Резус-фактор RBBP4/RBAP48 Джин ORF экспрессии кДНК клона плазмидыCG90743-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Histone-binding protein RBBP4, also known as Retinoblastoma-binding protein 4, Retinoblastoma-binding protein p48, Chromatin assembly factor 1 subunit C, Chromatin assembly factor I p48 subunit, Nucleosome-remodeling factor subunit RBAP48 and RBBP4, is a nucleus protein which belongs to the WD repeat RBAP46/RBAP48/MSI1 family. RBBP4 is a core histone-binding subunit that may target chromatin assembly factors, chromatin remodeling factors and histone deacetylases to their histone substrates in a manner that is regulated by nucleosomal DNA. RBBP4 is a component of several complexes which regulate chromatin metabolism. These include the chromatin assembly factor 1 (CAF-1) complex, which is required for chromatin assembly following DNA replication and DNA repair; the core histone deacetylase (HDAC) complex, which promotes histone deacetylation and consequent transcriptional repression; the nucleosome remodeling and histone deacetylase complex (the NuRD complex), which promotes transcriptional repression by histone deacetylation and nucleosome remodeling and the NURF (nucleosome remodeling factor) complex.

One common myth is that age-related memory loss is an early indication of Alzheimer's disease. But researchers at the Columbia University Medical Center in New York City have found a specific protein, RbAp48, that they believe is responsible for age-related memory problems. What's more, by replenishing RbAp48 in the brains of mice, the researchers were able to undo existing age-related memory damage.

To find RbAp48, researchers focused on the hippocampus, the region of the brain where memories are formed. After studying eight healthy brains donated to science by people between the ages of 33 and 88, they found that RbAp48 was reduced by nearly 50 percent in the older brains. The researchers found that when they turned off RbAp48 in younger mice, they became more forgetful, while increasing RbAp48 in older mice restored memory. The mice were given memory tests that included object recognition and water maze problems.

Ссылки
  • Rasmussen HH. et al.,1992, Electrophoresis 13:960-9.
  • Qian Y.-W. et al., 1993,  Nature 364:648-52.
  • Yarden R.I. et al., 1999, Proc. Natl. Acad. Sci. USA. 96: 4983-8.
  • Ota T. et al., 2004, Nat. Genet. 36:40-45.
  • Gauci S. et al., 2009, Anal. Chem. 81:4493-501.
  • Size / Price
    Каталог: CG90743-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».