RAB7A cDNA ORF Clone, Cynomolgus, C-HA tag

Price:
Size:
Number:

RAB7A cDNA ORF Clone, Cynomolgus, C-HA tag: General Information

Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
624 bp
Description
Full length Clone DNA of Cynomolgus RAB7A, member RAS oncogene family with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

RAB7A Background Information

RAB7A is a ubiquitous small GTPase, which controls transport to late endocytic compartments. Silencing or overexpression of wild type RAB7A changed the soluble/insoluble rate of peripherin indicating that RAB7A is important for peripherin organization and function. In addition, disease-causing RAB7A mutant proteins bind more strongly to peripherin and their expression causes a significant increase in the amount of soluble peripherin. The altered interaction between disease-causing RAB7A mutants and peripherin could play an important role in CMT2B neuropathy.
Full Name
RAB7A, member RAS oncogene family
Add to Cart Successfully Add to Cart Failed