RAB7A cDNA ORF Clone, Cynomolgus, C-HA tag

Price:
Size:
Number:

RAB7A cDNA ORF Clone, Cynomolgus, C-HA tag: General Information

Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
624 bp
Description
Full length Clone DNA of Cynomolgus RAB7A, member RAS oncogene family with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

RAB7A Background Information

RAB7A is a ubiquitous small GTPase, which controls transport to late endocytic compartments. Silencing or overexpression of wild type RAB7A changed the soluble/insoluble rate of peripherin indicating that RAB7A is important for peripherin organization and function. In addition, disease-causing RAB7A mutant proteins bind more strongly to peripherin and their expression causes a significant increase in the amount of soluble peripherin. The altered interaction between disease-causing RAB7A mutants and peripherin could play an important role in CMT2B neuropathy.
Full Name
RAB7A, member RAS oncogene family
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait