Быстрый заказ

Яванский макак RAB7A / Rab-7a Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Яванский макак RAB7A Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:XM_005571763.1
    Размер кДНК:624bp
    Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) RAB7A, member RAS oncogene family with C terminal HA tag.
    Синоним гена:RAB7A
    Виды:Cynomolgus
    переносчик:pCMV3-C-HA
    Plasmid:
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Яванский макак RAB7A / Rab-7a Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
    Яванский макак RAB7A / Rab-7a Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90388-ACGRBS15400
    Яванский макак RAB7A / Rab-7a Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90388-ACRRBS15400
    Яванский макак RAB7A / Rab-7a Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90388-ANGRBS15400
    Яванский макак RAB7A / Rab-7a Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90388-ANRRBS15400
    Яванский макак RAB7A / Rab-7a Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90388-CFRBS13340
    Яванский макак RAB7A / Rab-7a Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90388-CHRBS13340
    Яванский макак RAB7A / Rab-7a Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90388-CMRBS13340
    Яванский макак RAB7A / Rab-7a Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90388-CYRBS13340
    Яванский макак RAB7A / Rab-7a Джин клон кДНК в вектор клонированияCG90388-GRBS5130
    Яванский макак RAB7A / Rab-7a Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90388-NFRBS13340
    Яванский макак RAB7A / Rab-7a Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90388-NHRBS13340
    Яванский макак RAB7A / Rab-7a Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90388-NMRBS13340
    Яванский макак RAB7A / Rab-7a Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90388-NYRBS13340
    Яванский макак RAB7A / Rab-7a Джин ORF экспрессии кДНК клона плазмидыCG90388-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: CG90388-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».