After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Яванский макак PSMD13 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus PSMD13 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_005576701.1
Размер кДНК:1131bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) proteasome (prosome, macropain) 26S subunit, non-ATPase, 13.
Синоним гена:PSMD13
Виды:Cynomolgus
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Яванский макак PSMD13 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Яванский макак PSMD13 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90760-ACGRBS15400
Яванский макак PSMD13 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90760-ACRRBS15400
Яванский макак PSMD13 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90760-ANGRBS15400
Яванский макак PSMD13 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90760-ANRRBS15400
Яванский макак PSMD13 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90760-CFRBS13340
Яванский макак PSMD13 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90760-CHRBS13340
Яванский макак PSMD13 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90760-CMRBS13340
Яванский макак PSMD13 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90760-CYRBS13340
Яванский макак PSMD13 Джин клон кДНК в вектор клонированияCG90760-GRBS5130
Яванский макак PSMD13 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90760-NFRBS13340
Яванский макак PSMD13 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90760-NHRBS13340
Яванский макак PSMD13 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90760-NMRBS13340
Яванский макак PSMD13 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90760-NYRBS13340
Яванский макак PSMD13 Джин ORF экспрессии кДНК клона плазмидыCG90760-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90760-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».