After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Резус-фактор PSMC4 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus PSMC4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001266336.2
Размер кДНК:1257bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) proteasome (prosome, macropain) 26S subunit, ATPase, 4.
Синоним гена:PSMC4
Виды:Rhesus
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Резус-фактор PSMC4 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Резус-фактор PSMC4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90720-ACGRBS15400
Резус-фактор PSMC4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90720-ACRRBS15400
Резус-фактор PSMC4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90720-ANGRBS15400
Резус-фактор PSMC4 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90720-ANRRBS15400
Резус-фактор PSMC4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90720-CFRBS13340
Резус-фактор PSMC4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90720-CHRBS13340
Резус-фактор PSMC4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90720-CMRBS13340
Резус-фактор PSMC4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90720-CYRBS13340
Резус-фактор PSMC4 Джин клон кДНК в вектор клонированияCG90720-GRBS5130
Резус-фактор PSMC4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90720-NFRBS13340
Резус-фактор PSMC4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90720-NHRBS13340
Резус-фактор PSMC4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90720-NMRBS13340
Резус-фактор PSMC4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90720-NYRBS13340
Резус-фактор PSMC4 Джин ORF экспрессии кДНК клона плазмидыCG90720-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90720-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».