Быстрый заказ

Резус-фактор PPP2R2D Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Яванский макак PPP2R2D Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:XM_001091312.2
    Размер кДНК:867bp
    Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) serine/threonine-protein phosphatase 2A 55 kDa regulatory subunit B delta isoform-like.
    Синоним гена:PPP2R2D
    Виды:Rhesus
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Резус-фактор PPP2R2D Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Резус-фактор PPP2R2D Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90762-ACGRBS15400
    Резус-фактор PPP2R2D Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90762-ACRRBS15400
    Резус-фактор PPP2R2D Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90762-ANGRBS15400
    Резус-фактор PPP2R2D Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90762-ANRRBS15400
    Резус-фактор PPP2R2D Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90762-CFRBS13340
    Резус-фактор PPP2R2D Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90762-CHRBS13340
    Резус-фактор PPP2R2D Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90762-CMRBS13340
    Резус-фактор PPP2R2D Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90762-CYRBS13340
    Резус-фактор PPP2R2D Джин клон кДНК в вектор клонированияCG90762-GRBS5130
    Резус-фактор PPP2R2D Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90762-NFRBS13340
    Резус-фактор PPP2R2D Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90762-NHRBS13340
    Резус-фактор PPP2R2D Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90762-NMRBS13340
    Резус-фактор PPP2R2D Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90762-NYRBS13340
    Резус-фактор PPP2R2D Джин ORF экспрессии кДНК клона плазмидыCG90762-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: CG90762-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».