After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Яванский макак PNP Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus PNP Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_005560695.1
Размер кДНК:870bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) purine nucleoside phosphorylase with N terminal HA tag.
Синоним гена:PNP
Виды:Cynomolgus
переносчик:pCMV3-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Яванский макак PNP Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Яванский макак PNP Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90410-ACGRBS15396
Яванский макак PNP Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90410-ACRRBS15396
Яванский макак PNP Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90410-ANGRBS15396
Яванский макак PNP Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90410-ANRRBS15396
Яванский макак PNP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90410-CFRBS13343
Яванский макак PNP Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90410-CHRBS13343
Яванский макак PNP Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90410-CMRBS13343
Яванский макак PNP Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90410-CYRBS13343
Яванский макак PNP Джин клон кДНК в вектор клонированияCG90410-GRBS5132
Яванский макак PNP Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90410-NFRBS13343
Яванский макак PNP Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90410-NHRBS13343
Яванский макак PNP Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90410-NMRBS13343
Яванский макак PNP Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90410-NYRBS13343
Яванский макак PNP Джин ORF экспрессии кДНК клона плазмидыCG90410-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Ссылки
  • de Azevedo,W.F. et al., 2003, Biochem Biophys Res Commun. 312 (3): 767-72.
  • Canduri,F. et al., 2005, Acta Crystallogr D Biol Crystallogr. 61 (Pt 7): 856-62.
  • Perera,G.K. et al., 2005,Clin Exp Dermatol. 30 (1):27-9.
  • Size / Price
    Каталог: CG90410-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».