After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Резус-фактор PHB2/Prohibitin 2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus PHB2 Информация о продукте «Клон cDNA»
Размер кДНК:900bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) prohibitin 2 with N terminal His tag.
Синоним гена:PHB2
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Резус-фактор PHB2/Prohibitin 2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Резус-фактор PHB2/Prohibitin 2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90613-ACGRBS15396
Резус-фактор PHB2/Prohibitin 2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90613-ACRRBS15396
Резус-фактор PHB2/Prohibitin 2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90613-ANGRBS15396
Резус-фактор PHB2/Prohibitin 2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90613-ANRRBS15396
Резус-фактор PHB2/Prohibitin 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90613-CFRBS13343
Резус-фактор PHB2/Prohibitin 2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90613-CHRBS13343
Резус-фактор PHB2/Prohibitin 2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90613-CMRBS13343
Резус-фактор PHB2/Prohibitin 2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90613-CYRBS13343
Резус-фактор PHB2/Prohibitin 2 Джин клон кДНК в вектор клонированияCG90613-GRBS5132
Резус-фактор PHB2/Prohibitin 2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90613-NFRBS13343
Резус-фактор PHB2/Prohibitin 2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90613-NHRBS13343
Резус-фактор PHB2/Prohibitin 2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90613-NMRBS13343
Резус-фактор PHB2/Prohibitin 2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90613-NYRBS13343
Резус-фактор PHB2/Prohibitin 2 Джин ORF экспрессии кДНК клона плазмидыCG90613-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90613-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.