Быстрый заказ

Резус-фактор PEMT Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Яванский макак PEMT Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:XM_001090779.2
    Размер кДНК:711bp
    Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) phosphatidylethanolamine N-methyltransferase with C terminal His tag.
    Синоним гена:PEMT
    Виды:Rhesus
    переносчик:pCMV3-C-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Резус-фактор PEMT Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Резус-фактор PEMT Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90359-ACGRBS15400
    Резус-фактор PEMT Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90359-ACRRBS15400
    Резус-фактор PEMT Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90359-ANGRBS15400
    Резус-фактор PEMT Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90359-ANRRBS15400
    Резус-фактор PEMT Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90359-CFRBS13340
    Резус-фактор PEMT Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90359-CHRBS13340
    Резус-фактор PEMT Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90359-CMRBS13340
    Резус-фактор PEMT Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90359-CYRBS13340
    Резус-фактор PEMT Джин клон кДНК в вектор клонированияCG90359-GRBS5130
    Резус-фактор PEMT Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90359-NFRBS13340
    Резус-фактор PEMT Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90359-NHRBS13340
    Резус-фактор PEMT Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90359-NMRBS13340
    Резус-фактор PEMT Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90359-NYRBS13340
    Резус-фактор PEMT Джин ORF экспрессии кДНК клона плазмидыCG90359-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: CG90359-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».