Быстрый заказ

Резус-фактор PEMT Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus PEMT Информация о продукте «Клон cDNA»
Размер кДНК:711bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) phosphatidylethanolamine N-methyltransferase with C terminal His tag.
Синоним гена:PEMT
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Резус-фактор PEMT Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Резус-фактор PEMT Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90359-ACGRBS15396
Резус-фактор PEMT Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90359-ACRRBS15396
Резус-фактор PEMT Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90359-ANGRBS15396
Резус-фактор PEMT Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90359-ANRRBS15396
Резус-фактор PEMT Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90359-CFRBS13343
Резус-фактор PEMT Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90359-CHRBS13343
Резус-фактор PEMT Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90359-CMRBS13343
Резус-фактор PEMT Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90359-CYRBS13343
Резус-фактор PEMT Джин клон кДНК в вектор клонированияCG90359-GRBS5132
Резус-фактор PEMT Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90359-NFRBS13343
Резус-фактор PEMT Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90359-NHRBS13343
Резус-фактор PEMT Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90359-NMRBS13343
Резус-фактор PEMT Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90359-NYRBS13343
Резус-фактор PEMT Джин ORF экспрессии кДНК клона плазмидыCG90359-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90359-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.