After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Резус-фактор PDE6D Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus PDE6D Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001194606.1
Размер кДНК:453bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) phosphodiesterase 6D, cGMP-specific, rod, delta with N terminal HA tag.
Синоним гена:PDE6D
Виды:Rhesus
переносчик:pCMV3-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Резус-фактор PDE6D Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Резус-фактор PDE6D Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90422-ACGRBS15400
Резус-фактор PDE6D Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90422-ACRRBS15400
Резус-фактор PDE6D Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90422-ANGRBS15400
Резус-фактор PDE6D Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90422-ANRRBS15400
Резус-фактор PDE6D Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90422-CFRBS13340
Резус-фактор PDE6D Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90422-CHRBS13340
Резус-фактор PDE6D Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90422-CMRBS13340
Резус-фактор PDE6D Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90422-CYRBS13340
Резус-фактор PDE6D Джин клон кДНК в вектор клонированияCG90422-GRBS5130
Резус-фактор PDE6D Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90422-NFRBS13340
Резус-фактор PDE6D Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90422-NHRBS13340
Резус-фактор PDE6D Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90422-NMRBS13340
Резус-фактор PDE6D Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90422-NYRBS13340
Резус-фактор PDE6D Джин ORF экспрессии кДНК клона плазмидыCG90422-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90422-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».