Быстрый заказ

Резус-фактор PCNA Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus PCNA Информация о продукте «Клон cDNA»
Размер кДНК:786bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) proliferating cell nuclear antigen with C terminal His tag.
Синоним гена:PCNA
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Резус-фактор PCNA Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Резус-фактор PCNA Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90344-ACGRBS15400
Резус-фактор PCNA Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90344-ACRRBS15400
Резус-фактор PCNA Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90344-ANGRBS15400
Резус-фактор PCNA Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90344-ANRRBS15400
Резус-фактор PCNA Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90344-CFRBS13340
Резус-фактор PCNA Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90344-CHRBS13340
Резус-фактор PCNA Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90344-CMRBS13340
Резус-фактор PCNA Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90344-CYRBS13340
Резус-фактор PCNA Джин клон кДНК в вектор клонированияCG90344-GRBS5130
Резус-фактор PCNA Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90344-NFRBS13340
Резус-фактор PCNA Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90344-NHRBS13340
Резус-фактор PCNA Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90344-NMRBS13340
Резус-фактор PCNA Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90344-NYRBS13340
Резус-фактор PCNA Джин ORF экспрессии кДНК клона плазмидыCG90344-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Proliferating Cell Nuclear Antigen (PCNA) is a protein only expresse in nomal proliferate cells and cancer cells. It is central to both DNA replication and repair. One of the well-established functions for PCNA is its role as the processivity factor for DNA polymerase delta and epsilon. PCNA tethers the polymerase catalytic unit to the DNA template for rapid and processive DNA synthesis. Two forms of PCNA exist in cells: (i) a detergent-insoluble trimeric form stably associated with the replicating forks during S phase and (ii) a soluble form in quiescent cells in G1 and G2 phases. PCNA forms a toroidal trimer in S phase with replication factor-C (RF-C) and DNA in an ATP-dependent manner and enables the loading of DNA polymerase delta and epsilon onto the complex. The close association of PCNA with kinase complexes involved in cell cycle machinery indicates that PCNA has a regulatory role in cell cycle progression. PCNA also participates in the processing of branched intermediates that arise during the lagging strand DNA synthesis.

  • Balajee AS, et al. (2001) Chromatin-bound PCNA complex formation triggered by DNA damage occurs independent of the ATM gene product in human cells. Nucleic Acids Res. 29 (6): 1341-51.
  • Ducoux M, et al. (2001) Mediation of proliferating cell nuclear antigen (PCNA)-dependent DNA replication through a conserved p21(Cip1)-like PCNA-binding motif present in the third subunit of human DNA polymerase delta. J Biol Chem. 276 (52): 49258-66.
  • Tetsuo I, et al. (2002) PCNA clamp facilitates action of DNA cytosine methyltransferase 1 on hemimethylated DNA. Genes Cells. 7(10): 997-1007.
  • Size / Price
    Каталог: CG90344-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.