After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Резус-фактор PCBP4/MCG10 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus PCBP4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001260867.1
Размер кДНК:1212bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) poly(rC) binding protein 4.
Синоним гена:PCBP4
Виды:Rhesus
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Резус-фактор PCBP4/MCG10 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Резус-фактор PCBP4/MCG10 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90763-ACGRBS15400
Резус-фактор PCBP4/MCG10 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90763-ACRRBS15400
Резус-фактор PCBP4/MCG10 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90763-ANGRBS15400
Резус-фактор PCBP4/MCG10 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90763-ANRRBS15400
Резус-фактор PCBP4/MCG10 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90763-CFRBS13340
Резус-фактор PCBP4/MCG10 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90763-CHRBS13340
Резус-фактор PCBP4/MCG10 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90763-CMRBS13340
Резус-фактор PCBP4/MCG10 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90763-CYRBS13340
Резус-фактор PCBP4/MCG10 Джин клон кДНК в вектор клонированияCG90763-GRBS5130
Резус-фактор PCBP4/MCG10 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90763-NFRBS13340
Резус-фактор PCBP4/MCG10 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90763-NHRBS13340
Резус-фактор PCBP4/MCG10 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90763-NMRBS13340
Резус-фактор PCBP4/MCG10 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90763-NYRBS13340
Резус-фактор PCBP4/MCG10 Джин ORF экспрессии кДНК клона плазмидыCG90763-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90763-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».