After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Яванский макак OTUB1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus OTUB1 Информация о продукте «Клон cDNA»
Размер кДНК:816bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) OTU domain, ubiquitin aldehyde binding 1 with C terminal His tag.
Синоним гена:OTUB1
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name

Ubiquitin thioesterase OTUB1, also known as Deubiquitinating enzyme OTUB1, OTU domain-containing ubiquitin aldehyde-binding protein 1, Otubain-1, Ubiquitin-specific-processing protease OTUB1, OTUB1 and OTB1, is a cytoplasm protein which belongs to the peptidase C65 family. OTUB1 is a hydrolase that can remove conjugated ubiquitin from proteins and plays an important regulatory role at the level of protein turnover by preventing degradation. OTUB1 is a regulator of T-cell anergy, a phenomenon that occurs when T-cells are rendered unresponsive to antigen rechallenge and no longer respond to their cognate antigen. OTUB1 acts via its interaction with RNF128 / GRAIL, a crucial inductor of CD4 T-cell anergy. Isoform 1 of OTUB1 destabilizes RNF128, leading to prevent anergy. In contrast, isoform 2 of OTUB1 stabilizes RNF128 and promotes anergy. OTUB1 regulates RNF128-mediated ubiquitination, but does not deubiquitinate polyubiquitinated RNF128. Deubiquitinates estrogen receptor alpha (ESR1). OTUB1 mediates deubiquitination of 'Lys-48'-linked polyubiquitin chains, but not 'Lys-63'-linked polyubiquitin chains. OTUB1 is also capable of removing NEDD8 from NEDD8 conjugates, but with a much lower preference compared to 'Lys-48'-linked ubiquitin.

  • Balakirev M.Y., et al., 2003, EMBO Rep. 4:517-522.
  • Soares L., et al., 2004, Nat. Immunol. 5:45-54.
  • Stanisic V., et al., 2009, J. Biol. Chem. 284:16135-16145.
  • Choudhary C., et al., 2009, Science 325:834-840.
  • Edelmann M.J., et al., 2009, Biochem. J. 418:379-390.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.