Быстрый заказ

Яванский макак Opalin / TMEM10 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus OPALIN Информация о продукте «Клон cDNA»
Размер кДНК:426bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) oligodendrocytic myelin paranodal and inner loop protein with N terminal Myc tag.
Синоним гена:OPALIN
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Яванский макак Opalin / TMEM10 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Яванский макак Opalin / TMEM10 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90667-ACGRBS15400
Яванский макак Opalin / TMEM10 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90667-ACRRBS15400
Яванский макак Opalin / TMEM10 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90667-CFRBS13340
Яванский макак Opalin / TMEM10 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90667-CHRBS13340
Яванский макак Opalin / TMEM10 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90667-CMRBS13340
Яванский макак Opalin / TMEM10 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90667-CYRBS13340
Яванский макак Opalin / TMEM10 Джин клон кДНК в вектор клонированияCG90667-GRBS5130
Яванский макак Opalin / TMEM10 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90667-NFRBS13340
Яванский макак Opalin / TMEM10 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90667-NHRBS13340
Яванский макак Opalin / TMEM10 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90667-NMRBS13340
Яванский макак Opalin / TMEM10 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90667-NYRBS13340
Яванский макак Opalin / TMEM10 Джин ORF экспрессии кДНК клона плазмидыCG90667-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Opalin, or oligodendrocytic myelin paranodal and inner loop protein, is a transmembrane protein detected specifically in mammalian oligodendrocytes, and may play significant role in oligodendrocyte differentiation and myelination.Opalin has binding sites for Myt1 and cAMP-response element binding protein (CREB). Over-expression of Myt1, treatment of the cell with leukemia inhibitory factor (LIF), and cAMP analog (CREB activator) enhanced the expression of endogenous Opalin in Oli-neu cells and activated the oligodendrocyte enhancer. Thus LIF, cAMP signaling cascades and Myt1 may play significant roles in the differentiation of oligodendrocytes through their action on the Opalin oligodendrocyte enhancer. Enzymatic deglycosylation showed that myelin Opalin contained N- and O-glycans, and that the O-glycans, at least, had negatively charged sialic acids. Site-directed mutations at the glycan sites impaired the cell surface localization of Opalin. In addition to the somata and processes of oligodendrocytes, Opalin immunoreactivity was observed in myelinated axons in a spiral fashion, and was concentrated in the paranodal loop region. Immunogold electron microscopy demonstrated that Opalin was localized at particular sites in the paranodal loop membrane. These results suggest a role for highly sialylglycosylated Opalin in an intermembranous function of the myelin paranodal loops in the central nervous system.

  • Aruga J, et al. (2007) An oligodendrocyte enhancer in a phylogenetically conserved intron region of the mammalian myelin gene Opalin. J Neurochem. 102(5):1533-47.
  • Kippert A, et al. (2008) Identification of Tmem10/Opalin as a novel marker for oligodendrocytes using gene expression profiling. BMC Neurosci. 9:40.
  • Yoshikawa F, et al. (2008) Opalin, a transmembrane sialylglycoprotein located in the central nervous system myelin paranodal loop membrane. J Biol Chem. 83(30):20830-40.
  • Golan N, et al. (2008) Identification of Tmem10/Opalin as an oligodendrocyte enriched gene using expression profiling combined with genetic cell ablation. Glia. 56(11):1176-86.
  • Size / Price
    Каталог: CG90667-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.