NUDCD3 cDNA ORF Clone, Rhesus, C-His tag

Cat: CG90663-CH

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All NUDCD3 Reagents

CRO Services

Product recommended


All NUDCD3 Reagents

NUDCD3 cDNA ORF Clone, Rhesus, C-His tag General Information

Gene

Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1095 bp
Description
Full length Clone DNA of Rhesus NudC domain containing 3 with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NUDCD3 Background Information

Full Name
NudC domain containing 3

NUDCD3 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
NUDCD3 cDNA ORF Clone in Cloning Vector, Rhesus CG90663-G
NUDCD3 cDNA ORF Clone, Rhesus, untagged CG90663-UT
NUDCD3 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90663-ACGLN
NUDCD3 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90663-ACG
NUDCD3 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90663-ANG
NUDCD3 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90663-ACR
NUDCD3 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90663-ANR
NUDCD3 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90663-CF
NUDCD3 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90663-NF
NUDCD3 cDNA ORF Clone, Rhesus, N-His tag CG90663-NH
NUDCD3 cDNA ORF Clone, Rhesus, C-HA tag CG90663-CY
NUDCD3 cDNA ORF Clone, Rhesus, N-HA tag CG90663-NY
NUDCD3 cDNA ORF Clone, Rhesus, C-Myc tag CG90663-CM
NUDCD3 cDNA ORF Clone, Rhesus, N-Myc tag CG90663-NM

NUDCD3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NUDCD3 cDNA ORF Clone in Cloning Vector, Mouse MG52653-G
NUDCD3 cDNA ORF Clone, Mouse, untagged MG52653-UT
NUDCD3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52653-ACGLN
NUDCD3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52653-ACG
NUDCD3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52653-ANG
NUDCD3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52653-ACR
NUDCD3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52653-ANR
NUDCD3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52653-CF
NUDCD3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52653-NF
NUDCD3 cDNA ORF Clone, Mouse, C-His tag MG52653-CH
NUDCD3 cDNA ORF Clone, Mouse, N-His tag MG52653-NH
NUDCD3 cDNA ORF Clone, Mouse, C-HA tag MG52653-CY
NUDCD3 cDNA ORF Clone, Mouse, N-HA tag MG52653-NY
NUDCD3 cDNA ORF Clone, Mouse, C-Myc tag MG52653-CM
NUDCD3 cDNA ORF Clone, Mouse, N-Myc tag MG52653-NM
NUDCD3 qPCR Primer Pairs, Mouse MP202524

NUDCD3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NUDCD3 cDNA ORF Clone in Cloning Vector, Human HG21257-U
NUDCD3 cDNA ORF Clone, Human, untagged HG21257-UT
NUDCD3 cDNA ORF Clone, Human, C-GFPSpark® tag HG21257-ACG
NUDCD3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG21257-ACGLN
NUDCD3 cDNA ORF Clone, Human, N-GFPSpark® tag HG21257-ANG
NUDCD3 cDNA ORF Clone, Human, C-OFPSpark® tag HG21257-ACR
NUDCD3 cDNA ORF Clone, Human, N-OFPSpark® tag HG21257-ANR
NUDCD3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG21257-CF
NUDCD3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG21257-NF
NUDCD3 cDNA ORF Clone, Human, C-His tag HG21257-CH
NUDCD3 cDNA ORF Clone, Human, N-His tag HG21257-NH
NUDCD3 cDNA ORF Clone, Human, C-HA tag HG21257-CY
NUDCD3 cDNA ORF Clone, Human, N-HA tag HG21257-NY
NUDCD3 cDNA ORF Clone, Human, C-Myc tag HG21257-CM
NUDCD3 cDNA ORF Clone, Human, N-Myc tag HG21257-NM
info info
添加购物车成功! 添加购物车失败!