Быстрый заказ

Яванский макак TrkC/NTRK3 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Яванский макак NTRK3 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:XM_005560427.1
    Размер кДНК:1839bp
    Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) neurotrophic tyrosine kinase, receptor, type 3.
    Синоним гена:NTRK3
    Виды:Cynomolgus
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Яванский макак TrkC/NTRK3 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Яванский макак TrkC/NTRK3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90726-ACGRBS16760
    Яванский макак TrkC/NTRK3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90726-ACRRBS16760
    Яванский макак TrkC/NTRK3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90726-CFRBS14710
    Яванский макак TrkC/NTRK3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90726-CHRBS14710
    Яванский макак TrkC/NTRK3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90726-CMRBS14710
    Яванский макак TrkC/NTRK3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90726-CYRBS14710
    Яванский макак TrkC/NTRK3 Джин клон кДНК в вектор клонированияCG90726-GRBS5130
    Яванский макак TrkC/NTRK3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90726-NFRBS14710
    Яванский макак TrkC/NTRK3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90726-NHRBS14710
    Яванский макак TrkC/NTRK3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90726-NMRBS14710
    Яванский макак TrkC/NTRK3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90726-NYRBS14710
    Яванский макак TrkC/NTRK3 Джин ORF экспрессии кДНК клона плазмидыCG90726-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    NT-3 growth factor receptor also known as neurotrophic tyrosine kinase receptor type 3 or TrkC tyrosine kinase or Trk-C receptor, is a member of the neurotrophic tyrosine receptor kinase (NTRK) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. TrkC/NTRK3 is widely expressed in the developing and adult nervous system. In later embryonic development, TrkC/NTRK3 is expressed in various structures of the CNS including the caudatoputamen, septal nuclei, cerebellum, and brainstem. Other neurotrophins include nerve growth factor(NGF), neurotrophin-3 and neurotrophin-4. In the PNS, trkC hybridization appears to correlate, both temporally and spatially, with the outgrowth of axons toward their peripheral targets. TrkC/NTRK3 is widely expressed in the three identified branches of the mammalian nervous system and appears to correlate with the expression of NT-3, its cognate ligand. The apparent colocalization of trkC transcripts with NT-3 raises the possibility this neurotrophin exerts its trophic effects by a paracrine and/or autocrine mechanism. Signalling through this kinase leads to cell differentiation and may play a role in the development of proprioceptive neurons that sense body position. Mutations in TrkC encoding gene have been associated with medulloblastomas, secretory breast carcinomas and other cancers.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    Ссылки
  • Tessarollo L, et al. (1993) trkC, a receptor for neurotrophin-3, is widely expressed in the developing nervous system and in non-neuronal tissues. Development. 118(2): 463-75.
  • Lamballe F, et al. (1994) Developmental expression of trkC, the neurotrophin-3 receptor, in the mammalian nervous system. J Neurosci. 14(1): 14-28.
  • Klein R, et al. (1994) Disruption of the neurotrophin-3 receptor gene trkC eliminates la muscle afferents and results in abnormal movements. Nature. 368(6468): 249-51.
  • Size / Price
    Каталог: CG90726-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».