After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Яванский макак TrkC/NTRK3 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus NTRK3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_005560427.1
Размер кДНК:1839bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) neurotrophic tyrosine kinase, receptor, type 3.
Синоним гена:NTRK3
Виды:Cynomolgus
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Яванский макак TrkC/NTRK3 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Яванский макак TrkC/NTRK3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90726-ACGRBS16760
Яванский макак TrkC/NTRK3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90726-ACRRBS16760
Яванский макак TrkC/NTRK3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90726-CFRBS14710
Яванский макак TrkC/NTRK3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90726-CHRBS14710
Яванский макак TrkC/NTRK3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90726-CMRBS14710
Яванский макак TrkC/NTRK3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90726-CYRBS14710
Яванский макак TrkC/NTRK3 Джин клон кДНК в вектор клонированияCG90726-GRBS5130
Яванский макак TrkC/NTRK3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90726-NFRBS14710
Яванский макак TrkC/NTRK3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90726-NHRBS14710
Яванский макак TrkC/NTRK3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90726-NMRBS14710
Яванский макак TrkC/NTRK3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90726-NYRBS14710
Яванский макак TrkC/NTRK3 Джин ORF экспрессии кДНК клона плазмидыCG90726-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

NT-3 growth factor receptor also known as neurotrophic tyrosine kinase receptor type 3 or TrkC tyrosine kinase or Trk-C receptor, is a member of the neurotrophic tyrosine receptor kinase (NTRK) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. TrkC/NTRK3 is widely expressed in the developing and adult nervous system. In later embryonic development, TrkC/NTRK3 is expressed in various structures of the CNS including the caudatoputamen, septal nuclei, cerebellum, and brainstem. Other neurotrophins include nerve growth factor(NGF), neurotrophin-3 and neurotrophin-4. In the PNS, trkC hybridization appears to correlate, both temporally and spatially, with the outgrowth of axons toward their peripheral targets. TrkC/NTRK3 is widely expressed in the three identified branches of the mammalian nervous system and appears to correlate with the expression of NT-3, its cognate ligand. The apparent colocalization of trkC transcripts with NT-3 raises the possibility this neurotrophin exerts its trophic effects by a paracrine and/or autocrine mechanism. Signalling through this kinase leads to cell differentiation and may play a role in the development of proprioceptive neurons that sense body position. Mutations in TrkC encoding gene have been associated with medulloblastomas, secretory breast carcinomas and other cancers.

Ссылки
  • Tessarollo L, et al. (1993) trkC, a receptor for neurotrophin-3, is widely expressed in the developing nervous system and in non-neuronal tissues. Development. 118(2): 463-75.
  • Lamballe F, et al. (1994) Developmental expression of trkC, the neurotrophin-3 receptor, in the mammalian nervous system. J Neurosci. 14(1): 14-28.
  • Klein R, et al. (1994) Disruption of the neurotrophin-3 receptor gene trkC eliminates la muscle afferents and results in abnormal movements. Nature. 368(6468): 249-51.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».