After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Яванский макак NT5C3B Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus NT5C3B Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_005584199.1
Размер кДНК:903bp
Описание кДНК:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) 5'-nucleotidase, cytosolic IIIB with N terminal His tag.
Синоним гена:NT5C3B
Виды:Cynomolgus
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Яванский макак NT5C3B Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Яванский макак NT5C3B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90594-ACGRBS15400
Яванский макак NT5C3B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90594-ACRRBS15400
Яванский макак NT5C3B Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90594-ANGRBS15400
Яванский макак NT5C3B Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90594-ANRRBS15400
Яванский макак NT5C3B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90594-CFRBS13340
Яванский макак NT5C3B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90594-CHRBS13340
Яванский макак NT5C3B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90594-CMRBS13340
Яванский макак NT5C3B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90594-CYRBS13340
Яванский макак NT5C3B Джин клон кДНК в вектор клонированияCG90594-GRBS5130
Яванский макак NT5C3B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90594-NFRBS13340
Яванский макак NT5C3B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90594-NHRBS13340
Яванский макак NT5C3B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90594-NMRBS13340
Яванский макак NT5C3B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90594-NYRBS13340
Яванский макак NT5C3B Джин ORF экспрессии кДНК клона плазмидыCG90594-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».