After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Резус-фактор SNAP-alpha Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus NAPA Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001194588.1
Размер кДНК:888bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) N-ethylmaleimide-sensitive factor attachment protein, alpha with C terminal His tag.
Синоним гена:NAPA
Виды:Rhesus
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Резус-фактор SNAP-alpha Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Резус-фактор SNAP-alpha Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90825-ACGRBS15400
Резус-фактор SNAP-alpha Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90825-ACRRBS15400
Резус-фактор SNAP-alpha Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90825-ANGRBS15400
Резус-фактор SNAP-alpha Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90825-ANRRBS15400
Резус-фактор SNAP-alpha Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90825-CFRBS13340
Резус-фактор SNAP-alpha Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90825-CHRBS13340
Резус-фактор SNAP-alpha Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90825-CMRBS13340
Резус-фактор SNAP-alpha Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90825-CYRBS13340
Резус-фактор SNAP-alpha Джин клон кДНК в вектор клонированияCG90825-GRBS5130
Резус-фактор SNAP-alpha Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90825-NFRBS13340
Резус-фактор SNAP-alpha Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90825-NHRBS13340
Резус-фактор SNAP-alpha Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90825-NMRBS13340
Резус-фактор SNAP-alpha Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90825-NYRBS13340
Резус-фактор SNAP-alpha Джин ORF экспрессии кДНК клона плазмидыCG90825-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90825-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».