Быстрый заказ

Text Size:AAA

Резус-фактор MVD/Diphosphomevalonate decarboxylase Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Cynomolgus MVD Информация о продукте «Клон cDNA»
Размер кДНК:1206bp
Описание кДНК:Full length Clone DNA of Macaca mulatta (Rhesus monkey) mevalonate (diphospho) decarboxylase with C terminal HA tag.
Синоним гена:MVD
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Резус-фактор MVD/Diphosphomevalonate decarboxylase Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Резус-фактор MVD/Diphosphomevalonate decarboxylase Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаCG90403-ACGRBS15400
Резус-фактор MVD/Diphosphomevalonate decarboxylase Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаCG90403-ACRRBS15400
Резус-фактор MVD/Diphosphomevalonate decarboxylase Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаCG90403-ANGRBS15400
Резус-фактор MVD/Diphosphomevalonate decarboxylase Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаCG90403-ANRRBS15400
Резус-фактор MVD/Diphosphomevalonate decarboxylase Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаCG90403-CFRBS13340
Резус-фактор MVD/Diphosphomevalonate decarboxylase Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаCG90403-CHRBS13340
Резус-фактор MVD/Diphosphomevalonate decarboxylase Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаCG90403-CMRBS13340
Резус-фактор MVD/Diphosphomevalonate decarboxylase Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаCG90403-CYRBS13340
Резус-фактор MVD/Diphosphomevalonate decarboxylase Джин клон кДНК в вектор клонированияCG90403-GRBS5130
Резус-фактор MVD/Diphosphomevalonate decarboxylase Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаCG90403-NFRBS13340
Резус-фактор MVD/Diphosphomevalonate decarboxylase Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаCG90403-NHRBS13340
Резус-фактор MVD/Diphosphomevalonate decarboxylase Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаCG90403-NMRBS13340
Резус-фактор MVD/Diphosphomevalonate decarboxylase Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаCG90403-NYRBS13340
Резус-фактор MVD/Diphosphomevalonate decarboxylase Джин ORF экспрессии кДНК клона плазмидыCG90403-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: CG90403-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.